rabbit polyclonal anti-wave2 antibody (cat Search Results


95
Cell Signaling Technology Inc anti wave 2
Anti Wave 2, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/anti wave 2/product/Cell Signaling Technology Inc
Average 95 stars, based on 1 article reviews
anti wave 2 - by Bioz Stars, 2026-03
95/100 stars
  Buy from Supplier

90
Millipore wave2 3 † aucagggugaggugggaaagauggg uagucccacuccacccuuucuaccc
Small interference RNA (siRNA) and antibodies used in RNA interference experiments in the present study
Wave2 3 † Aucagggugaggugggaaagauggg Uagucccacuccacccuuucuaccc, supplied by Millipore, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/wave2 3 † aucagggugaggugggaaagauggg uagucccacuccacccuuucuaccc/product/Millipore
Average 90 stars, based on 1 article reviews
wave2 3 † aucagggugaggugggaaagauggg uagucccacuccacccuuucuaccc - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

93
Santa Cruz Biotechnology anti wave2 polyclonal antibody
Figure 3. Analysis of WAVE1, <t>WAVE2,</t> and WAVE3 protein levels. Western analysis was performed on 50 g of protein extracted from the cerebral cortex and hippocampus of wild- type(Wt)miceaswellasfrommiceheterozygous(Het)andhomozygous(KO)forthegene-trap insertion (n 3). The analysis was performed using an anti-WAVE1 polyclonal primary anti- body (A), an anti-WAVE2 polyclonal primary antibody (B), and an anti-WAVE3 polyclonal pri- maryantibody(C).Allblotswerenormalizedbyreprobingwithananti-actinprimaryantibody. Error bars indicate SEM.
Anti Wave2 Polyclonal Antibody, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/anti wave2 polyclonal antibody/product/Santa Cruz Biotechnology
Average 93 stars, based on 1 article reviews
anti wave2 polyclonal antibody - by Bioz Stars, 2026-03
93/100 stars
  Buy from Supplier

90
Santa Cruz Biotechnology rabbit polyclonal anti-wave2 antibody (cat#: 3659)
Effects of SKAP2 RNAi on ARP2 and <t>WAVE2</t> expression. (A) Subcellular localization of ARP2 after SKAP2 siRNA injection. ARP2 was mainly distributed at the membrane in the control oocytes, whereas ARP2 expression was barely detectable in the siRNA-injected group. Green: ARP2; blue: chromatin. Bar = 20 μm. (B) Localization of WAVE2 after SKAP2 siRNA injection. WAVE2 was expressed around the spindle, whereas no specific localization of WAVE2 was observed around spindle in the siRNA-injected group. Red: WAVE2; blue: chromatin. Bar = 20 μm. (C) The fluorescence intensity of ARP2 in the SKAP2 siRNA-injected oocytes was decreased. (D) The fluorescence intensity of WAVE2 in SKAP2 siRNA-injected oocytes was significantly reduced. (E) ARP2 expression was reduced after SKAP2 siRNA injection by western blotting examination, as the relative intensity of ARP2 protein was significantly decreased. (F) WAVE2 expression was decreased after SKAP2 siRNA injection by western blotting analysis, as the relative intensity of WAVE2 protein was significantly reduced. *: significant difference (P < 0.05).
Rabbit Polyclonal Anti Wave2 Antibody (Cat#: 3659), supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/rabbit polyclonal anti-wave2 antibody (cat#: 3659)/product/Santa Cruz Biotechnology
Average 90 stars, based on 1 article reviews
rabbit polyclonal anti-wave2 antibody (cat#: 3659) - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

96
Santa Cruz Biotechnology goat anti wave2 polyclonal antibody
FIGURE 1. Dysbindin-1A and -1C have distinct spatial and temporal expression patterns and dysbindin-1C is not a subunit of the BLOC-1 complex. Tissue extracts from DBA/2J mice were subjected to SDS-PAGE followed by Western blotting using anti-dysbindin-1 antibody. The brain extract from sdy was used as a negative control, and -actin was used as a loading control. These experiments were repeated three times independently. A, dysbindin-1A is widely expressed in multiple mouse tissues, whereas dysbindin-1C is only expressed in the brain and spinal cord. B, in brain sub-regions, the dysbindin-1A levels are higher than dysbindin-1C in the olfactory bulb, substantia nigra, cerebellar cortex, and brain stem, but dysbindin-1C has higher expression levels than dysbindin-1A in the striatum, cerebral cortex, and hippocampal formation. C, dysbindin-1C is mainly enriched in the synaptic vesicles, whereas dysbindin-1A is mainly localized in the presynaptic membrane. In addition, both dysbindin-1A and -1C are found in the proportion of postsynaptic density. Successful synaptic fractionation is confirmed with VAMP2 as a marker for synaptic vesicles and GluR1 as a marker for the postsynaptic density. D and E, protein levels of dysbindin-1A in the hippocampal formation are gradually decreased. In contrast, the dysbindin-1C expression levels increase at postnatal stages. The chart in E is plotted by the relative intensities (IOD) of the bands in D. F, sedimentation velocity analyses. Mouse brain cytosol was fractioned by ultracentrifugation on a 5–20% (w/v) sucrose gradient and probed with antibodies against dysbindin-1, BLOS1, -dystrobrevin, and <t>WAVE2</t> by immunoblotting. Fractions 1 and 20 correspond to the top and bottom ends of the gradient, respectively. Dysbindin-1C does not co-sediment with subunits of the BLOC-1 complex, including dysbindin-1A and BLOS1. Moreover, dysbindin-1C does not form a stable DPC complex with -dystrobrevin nor a stable ternary complex with WAVE2 and Abi-1. Arrowheads, nonspecific bands. G, destabilization of the dysbindin-1 in extracts of three BLOC-1 mutants (sdy, pa, and mu). Sdy is the mutant of dysbindin-1; mu is the mutant of muted; and pa is the mutant of pallidin. Inbred strain DBA/2J served as the control for sdy, CHMU/Le for mu, and C57BL/6J for pa.
Goat Anti Wave2 Polyclonal Antibody, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/goat anti wave2 polyclonal antibody/product/Santa Cruz Biotechnology
Average 96 stars, based on 1 article reviews
goat anti wave2 polyclonal antibody - by Bioz Stars, 2026-03
96/100 stars
  Buy from Supplier

95
Proteintech anti wave 2
FIGURE 1. Dysbindin-1A and -1C have distinct spatial and temporal expression patterns and dysbindin-1C is not a subunit of the BLOC-1 complex. Tissue extracts from DBA/2J mice were subjected to SDS-PAGE followed by Western blotting using anti-dysbindin-1 antibody. The brain extract from sdy was used as a negative control, and -actin was used as a loading control. These experiments were repeated three times independently. A, dysbindin-1A is widely expressed in multiple mouse tissues, whereas dysbindin-1C is only expressed in the brain and spinal cord. B, in brain sub-regions, the dysbindin-1A levels are higher than dysbindin-1C in the olfactory bulb, substantia nigra, cerebellar cortex, and brain stem, but dysbindin-1C has higher expression levels than dysbindin-1A in the striatum, cerebral cortex, and hippocampal formation. C, dysbindin-1C is mainly enriched in the synaptic vesicles, whereas dysbindin-1A is mainly localized in the presynaptic membrane. In addition, both dysbindin-1A and -1C are found in the proportion of postsynaptic density. Successful synaptic fractionation is confirmed with VAMP2 as a marker for synaptic vesicles and GluR1 as a marker for the postsynaptic density. D and E, protein levels of dysbindin-1A in the hippocampal formation are gradually decreased. In contrast, the dysbindin-1C expression levels increase at postnatal stages. The chart in E is plotted by the relative intensities (IOD) of the bands in D. F, sedimentation velocity analyses. Mouse brain cytosol was fractioned by ultracentrifugation on a 5–20% (w/v) sucrose gradient and probed with antibodies against dysbindin-1, BLOS1, -dystrobrevin, and <t>WAVE2</t> by immunoblotting. Fractions 1 and 20 correspond to the top and bottom ends of the gradient, respectively. Dysbindin-1C does not co-sediment with subunits of the BLOC-1 complex, including dysbindin-1A and BLOS1. Moreover, dysbindin-1C does not form a stable DPC complex with -dystrobrevin nor a stable ternary complex with WAVE2 and Abi-1. Arrowheads, nonspecific bands. G, destabilization of the dysbindin-1 in extracts of three BLOC-1 mutants (sdy, pa, and mu). Sdy is the mutant of dysbindin-1; mu is the mutant of muted; and pa is the mutant of pallidin. Inbred strain DBA/2J served as the control for sdy, CHMU/Le for mu, and C57BL/6J for pa.
Anti Wave 2, supplied by Proteintech, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/anti wave 2/product/Proteintech
Average 95 stars, based on 1 article reviews
anti wave 2 - by Bioz Stars, 2026-03
95/100 stars
  Buy from Supplier

94
Cell Signaling Technology Inc rabbit anti wave 2
FIGURE 1. Dysbindin-1A and -1C have distinct spatial and temporal expression patterns and dysbindin-1C is not a subunit of the BLOC-1 complex. Tissue extracts from DBA/2J mice were subjected to SDS-PAGE followed by Western blotting using anti-dysbindin-1 antibody. The brain extract from sdy was used as a negative control, and -actin was used as a loading control. These experiments were repeated three times independently. A, dysbindin-1A is widely expressed in multiple mouse tissues, whereas dysbindin-1C is only expressed in the brain and spinal cord. B, in brain sub-regions, the dysbindin-1A levels are higher than dysbindin-1C in the olfactory bulb, substantia nigra, cerebellar cortex, and brain stem, but dysbindin-1C has higher expression levels than dysbindin-1A in the striatum, cerebral cortex, and hippocampal formation. C, dysbindin-1C is mainly enriched in the synaptic vesicles, whereas dysbindin-1A is mainly localized in the presynaptic membrane. In addition, both dysbindin-1A and -1C are found in the proportion of postsynaptic density. Successful synaptic fractionation is confirmed with VAMP2 as a marker for synaptic vesicles and GluR1 as a marker for the postsynaptic density. D and E, protein levels of dysbindin-1A in the hippocampal formation are gradually decreased. In contrast, the dysbindin-1C expression levels increase at postnatal stages. The chart in E is plotted by the relative intensities (IOD) of the bands in D. F, sedimentation velocity analyses. Mouse brain cytosol was fractioned by ultracentrifugation on a 5–20% (w/v) sucrose gradient and probed with antibodies against dysbindin-1, BLOS1, -dystrobrevin, and <t>WAVE2</t> by immunoblotting. Fractions 1 and 20 correspond to the top and bottom ends of the gradient, respectively. Dysbindin-1C does not co-sediment with subunits of the BLOC-1 complex, including dysbindin-1A and BLOS1. Moreover, dysbindin-1C does not form a stable DPC complex with -dystrobrevin nor a stable ternary complex with WAVE2 and Abi-1. Arrowheads, nonspecific bands. G, destabilization of the dysbindin-1 in extracts of three BLOC-1 mutants (sdy, pa, and mu). Sdy is the mutant of dysbindin-1; mu is the mutant of muted; and pa is the mutant of pallidin. Inbred strain DBA/2J served as the control for sdy, CHMU/Le for mu, and C57BL/6J for pa.
Rabbit Anti Wave 2, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/rabbit anti wave 2/product/Cell Signaling Technology Inc
Average 94 stars, based on 1 article reviews
rabbit anti wave 2 - by Bioz Stars, 2026-03
94/100 stars
  Buy from Supplier

96
Santa Cruz Biotechnology antiwave2
FIGURE 1. Dysbindin-1A and -1C have distinct spatial and temporal expression patterns and dysbindin-1C is not a subunit of the BLOC-1 complex. Tissue extracts from DBA/2J mice were subjected to SDS-PAGE followed by Western blotting using anti-dysbindin-1 antibody. The brain extract from sdy was used as a negative control, and -actin was used as a loading control. These experiments were repeated three times independently. A, dysbindin-1A is widely expressed in multiple mouse tissues, whereas dysbindin-1C is only expressed in the brain and spinal cord. B, in brain sub-regions, the dysbindin-1A levels are higher than dysbindin-1C in the olfactory bulb, substantia nigra, cerebellar cortex, and brain stem, but dysbindin-1C has higher expression levels than dysbindin-1A in the striatum, cerebral cortex, and hippocampal formation. C, dysbindin-1C is mainly enriched in the synaptic vesicles, whereas dysbindin-1A is mainly localized in the presynaptic membrane. In addition, both dysbindin-1A and -1C are found in the proportion of postsynaptic density. Successful synaptic fractionation is confirmed with VAMP2 as a marker for synaptic vesicles and GluR1 as a marker for the postsynaptic density. D and E, protein levels of dysbindin-1A in the hippocampal formation are gradually decreased. In contrast, the dysbindin-1C expression levels increase at postnatal stages. The chart in E is plotted by the relative intensities (IOD) of the bands in D. F, sedimentation velocity analyses. Mouse brain cytosol was fractioned by ultracentrifugation on a 5–20% (w/v) sucrose gradient and probed with antibodies against dysbindin-1, BLOS1, -dystrobrevin, and <t>WAVE2</t> by immunoblotting. Fractions 1 and 20 correspond to the top and bottom ends of the gradient, respectively. Dysbindin-1C does not co-sediment with subunits of the BLOC-1 complex, including dysbindin-1A and BLOS1. Moreover, dysbindin-1C does not form a stable DPC complex with -dystrobrevin nor a stable ternary complex with WAVE2 and Abi-1. Arrowheads, nonspecific bands. G, destabilization of the dysbindin-1 in extracts of three BLOC-1 mutants (sdy, pa, and mu). Sdy is the mutant of dysbindin-1; mu is the mutant of muted; and pa is the mutant of pallidin. Inbred strain DBA/2J served as the control for sdy, CHMU/Le for mu, and C57BL/6J for pa.
Antiwave2, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/antiwave2/product/Santa Cruz Biotechnology
Average 96 stars, based on 1 article reviews
antiwave2 - by Bioz Stars, 2026-03
96/100 stars
  Buy from Supplier

90
Upstate Biotechnology Inc rabbit anti-human wave2 polyclonal ab
FIGURE 1. Dysbindin-1A and -1C have distinct spatial and temporal expression patterns and dysbindin-1C is not a subunit of the BLOC-1 complex. Tissue extracts from DBA/2J mice were subjected to SDS-PAGE followed by Western blotting using anti-dysbindin-1 antibody. The brain extract from sdy was used as a negative control, and -actin was used as a loading control. These experiments were repeated three times independently. A, dysbindin-1A is widely expressed in multiple mouse tissues, whereas dysbindin-1C is only expressed in the brain and spinal cord. B, in brain sub-regions, the dysbindin-1A levels are higher than dysbindin-1C in the olfactory bulb, substantia nigra, cerebellar cortex, and brain stem, but dysbindin-1C has higher expression levels than dysbindin-1A in the striatum, cerebral cortex, and hippocampal formation. C, dysbindin-1C is mainly enriched in the synaptic vesicles, whereas dysbindin-1A is mainly localized in the presynaptic membrane. In addition, both dysbindin-1A and -1C are found in the proportion of postsynaptic density. Successful synaptic fractionation is confirmed with VAMP2 as a marker for synaptic vesicles and GluR1 as a marker for the postsynaptic density. D and E, protein levels of dysbindin-1A in the hippocampal formation are gradually decreased. In contrast, the dysbindin-1C expression levels increase at postnatal stages. The chart in E is plotted by the relative intensities (IOD) of the bands in D. F, sedimentation velocity analyses. Mouse brain cytosol was fractioned by ultracentrifugation on a 5–20% (w/v) sucrose gradient and probed with antibodies against dysbindin-1, BLOS1, -dystrobrevin, and <t>WAVE2</t> by immunoblotting. Fractions 1 and 20 correspond to the top and bottom ends of the gradient, respectively. Dysbindin-1C does not co-sediment with subunits of the BLOC-1 complex, including dysbindin-1A and BLOS1. Moreover, dysbindin-1C does not form a stable DPC complex with -dystrobrevin nor a stable ternary complex with WAVE2 and Abi-1. Arrowheads, nonspecific bands. G, destabilization of the dysbindin-1 in extracts of three BLOC-1 mutants (sdy, pa, and mu). Sdy is the mutant of dysbindin-1; mu is the mutant of muted; and pa is the mutant of pallidin. Inbred strain DBA/2J served as the control for sdy, CHMU/Le for mu, and C57BL/6J for pa.
Rabbit Anti Human Wave2 Polyclonal Ab, supplied by Upstate Biotechnology Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/rabbit anti-human wave2 polyclonal ab/product/Upstate Biotechnology Inc
Average 90 stars, based on 1 article reviews
rabbit anti-human wave2 polyclonal ab - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Abbkine Inc anti-wave2

Anti Wave2, supplied by Abbkine Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/anti-wave2/product/Abbkine Inc
Average 90 stars, based on 1 article reviews
anti-wave2 - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Thermo Fisher rabbit abs to wave2 thermo fisher pa5-60975 antibody
<t>WAVE2</t> contributes to the ability of B cells to spread on immobilized anti-Ig. ( A ) A20 B-lymphoma cells and primary B cells were transfected with control siRNA or WAVE2 siRNA and analyzed via immunoblotting with Abs to WAVE2 or actin. WAVE2 band intensities were normalized to the actin loading control for the same sample and expressed relative to values for control siRNA-transfected cells. Full uncropped blots are shown in . ( B – D ) A20 cells were transfected with control siRNA or WAVE2 siRNA (WAVE2 KD) or pre-treated for 1 h with 100 µM CK-666. The cells were added to coverslips coated with 2.4 μg/cm 2 anti-IgG for the indicated times and then stained with rhodamine-phalloidin to visualize F-actin. Representative images are shown in panel ( B ). Scale bars: 10 µm. Cell areas were quantified using ImageJ version 10.9.0. Panel ( C ) shows one of three independent experiments with similar results. Each dot is one cell, and the medians and interquartile ranges are shown for >25 cells per condition. p -values were calculated using the Mann–Whitney U test. Panel D shows combined data from 3 independent experiments. Each symbol is an individual experiment and the data are presented as the mean ± SEM for the median values from the 3 experiments. p -values were calculated using two-tailed paired t -tests. ( E – G ) Control siRNA- and WAVE2 siRNA-transfected A20 cells were added to coverslips that had been coated with 2.4 μg/cm 2 anti-IgG for the indicated times and then stained with rhodamine-phalloidin. The data are presented as in panels ( B – D ). ( H – J ) Primary B cells transfected with control siRNA or WAVE2 siRNA (WAVE2 KD) were added to coverslips coated with 2.4 μg/cm 2 anti-IgM for the indicated times and then stained with rhodamine-phalloidin. The data are presented as in panels ( B – D ). All scale bars are 10 µm.
Rabbit Abs To Wave2 Thermo Fisher Pa5 60975 Antibody, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/rabbit abs to wave2 thermo fisher pa5-60975 antibody/product/Thermo Fisher
Average 90 stars, based on 1 article reviews
rabbit abs to wave2 thermo fisher pa5-60975 antibody - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

93
ECM Biosciences anti py150 wave2
<t>WAVE2</t> contributes to the ability of B cells to spread on immobilized anti-Ig. ( A ) A20 B-lymphoma cells and primary B cells were transfected with control siRNA or WAVE2 siRNA and analyzed via immunoblotting with Abs to WAVE2 or actin. WAVE2 band intensities were normalized to the actin loading control for the same sample and expressed relative to values for control siRNA-transfected cells. Full uncropped blots are shown in . ( B – D ) A20 cells were transfected with control siRNA or WAVE2 siRNA (WAVE2 KD) or pre-treated for 1 h with 100 µM CK-666. The cells were added to coverslips coated with 2.4 μg/cm 2 anti-IgG for the indicated times and then stained with rhodamine-phalloidin to visualize F-actin. Representative images are shown in panel ( B ). Scale bars: 10 µm. Cell areas were quantified using ImageJ version 10.9.0. Panel ( C ) shows one of three independent experiments with similar results. Each dot is one cell, and the medians and interquartile ranges are shown for >25 cells per condition. p -values were calculated using the Mann–Whitney U test. Panel D shows combined data from 3 independent experiments. Each symbol is an individual experiment and the data are presented as the mean ± SEM for the median values from the 3 experiments. p -values were calculated using two-tailed paired t -tests. ( E – G ) Control siRNA- and WAVE2 siRNA-transfected A20 cells were added to coverslips that had been coated with 2.4 μg/cm 2 anti-IgG for the indicated times and then stained with rhodamine-phalloidin. The data are presented as in panels ( B – D ). ( H – J ) Primary B cells transfected with control siRNA or WAVE2 siRNA (WAVE2 KD) were added to coverslips coated with 2.4 μg/cm 2 anti-IgM for the indicated times and then stained with rhodamine-phalloidin. The data are presented as in panels ( B – D ). All scale bars are 10 µm.
Anti Py150 Wave2, supplied by ECM Biosciences, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/anti py150 wave2/product/ECM Biosciences
Average 93 stars, based on 1 article reviews
anti py150 wave2 - by Bioz Stars, 2026-03
93/100 stars
  Buy from Supplier

Image Search Results


Small interference RNA (siRNA) and antibodies used in RNA interference experiments in the present study

Journal: Cancer Science

Article Title: WAVE2‐ and microtubule‐dependent formation of long protrusions and invasion of cancer cells cultured on three‐dimensional extracellular matrices

doi: 10.1111/j.1349-7006.2008.00927.x

Figure Lengend Snippet: Small interference RNA (siRNA) and antibodies used in RNA interference experiments in the present study

Article Snippet: Table 1 Target siRNA Antibody for detection of protein N‐WASP GAAAUGUGUGACUAUGUCUTT TTCUUUACACACUGAUACAGA Cell signaling, rabbit MAb (30D10) WAVE1 UCCUUCGUAUUUCUUUGAUTT TTAGGAAGCAUAAAGAAACUA Santa Cruz, goat pAb (L‐19) WAVE2‐1 † AAACCAGAUCCUCUUUGGUUGUCCA UUUGGUCUAGGAGAAACCAACAGGU Chemicon, rabbit pAb (AB4226) WAVE3 CUUCUACAUCAGAGCAAAUTT TTGAAGAUGUAGUCUCGUUUA Santa Cruz, goat pAb (N‐16) WAVE2‐2 † UAUCAUUGGAGGCGGAGGUGGCGGA AUAGUAACCUCCGCCUCCACCGCCU Chemicon, rabbit pAb (AB4226) WAVE2‐3 † AUCAGGGUGAGGUGGGAAAGAUGGG UAGUCCCACUCCACCCUUUCUACCC Chemicon, rabbit pAb (AB4226) Control GACGUGAAACCGAAGAACGTT TTCUGCAGUUUGGCUUCUUGC Open in a separate window † Invitrogen stealth siRNA.

Techniques:

(a–c) Reduction of neural Wiskott–Aldrich Syndrome protein (N‐WASP) or WASP family Verprolin‐homologous protein (WAVE) family proteins by RNA interference in MDA‐MB‐231 cells. Cells were transfected with small interference RNA (siRNA) for 24 h and further cultured for 24 h, then part of the cells was used to extraction of proteins and the rest were plated on 3‐D gel. Western blot analyzes of N‐WASP (a), WAVE family proteins (b) and WAVE2 (c) expression. (d and e) Effect of siRNA on the formation of long protrusions and invasion. Cells transfected with siRNA were cultured on 3‐D gel for 18 h. Results of cells transfected with specific siRNA are normalized to those of cells treated with control siRNA as 100 in each experiment. Averages of the results of repeated experiments (N: number of experiments) are shown with standard deviations (error bars). Asterisks mark the results with P‐values of Student's t‐test less than 0.05. (f) Effect of siRNA on the formation of invadopodia. Cells transfected with siRNA for 48 h were plated onto Oregon Green 488 conjugated‐gelatin film and cultured for 18 h. The cells with one or more sites in which focally degraded‐gelatin and a punctate aggregate of F‐actin were judged to form invadopodia. Averages of the results of four independent experiments are shown with standard deviations (error bars). P‐values of Student's t‐test for the difference between the results with control siRNA and either N‐WASP or WAVE2 siRNA are noted in the figure. Those with control siRNA and siRNA for WAVE1 or WAVE3 exceeded 0.1.

Journal: Cancer Science

Article Title: WAVE2‐ and microtubule‐dependent formation of long protrusions and invasion of cancer cells cultured on three‐dimensional extracellular matrices

doi: 10.1111/j.1349-7006.2008.00927.x

Figure Lengend Snippet: (a–c) Reduction of neural Wiskott–Aldrich Syndrome protein (N‐WASP) or WASP family Verprolin‐homologous protein (WAVE) family proteins by RNA interference in MDA‐MB‐231 cells. Cells were transfected with small interference RNA (siRNA) for 24 h and further cultured for 24 h, then part of the cells was used to extraction of proteins and the rest were plated on 3‐D gel. Western blot analyzes of N‐WASP (a), WAVE family proteins (b) and WAVE2 (c) expression. (d and e) Effect of siRNA on the formation of long protrusions and invasion. Cells transfected with siRNA were cultured on 3‐D gel for 18 h. Results of cells transfected with specific siRNA are normalized to those of cells treated with control siRNA as 100 in each experiment. Averages of the results of repeated experiments (N: number of experiments) are shown with standard deviations (error bars). Asterisks mark the results with P‐values of Student's t‐test less than 0.05. (f) Effect of siRNA on the formation of invadopodia. Cells transfected with siRNA for 48 h were plated onto Oregon Green 488 conjugated‐gelatin film and cultured for 18 h. The cells with one or more sites in which focally degraded‐gelatin and a punctate aggregate of F‐actin were judged to form invadopodia. Averages of the results of four independent experiments are shown with standard deviations (error bars). P‐values of Student's t‐test for the difference between the results with control siRNA and either N‐WASP or WAVE2 siRNA are noted in the figure. Those with control siRNA and siRNA for WAVE1 or WAVE3 exceeded 0.1.

Article Snippet: Table 1 Target siRNA Antibody for detection of protein N‐WASP GAAAUGUGUGACUAUGUCUTT TTCUUUACACACUGAUACAGA Cell signaling, rabbit MAb (30D10) WAVE1 UCCUUCGUAUUUCUUUGAUTT TTAGGAAGCAUAAAGAAACUA Santa Cruz, goat pAb (L‐19) WAVE2‐1 † AAACCAGAUCCUCUUUGGUUGUCCA UUUGGUCUAGGAGAAACCAACAGGU Chemicon, rabbit pAb (AB4226) WAVE3 CUUCUACAUCAGAGCAAAUTT TTGAAGAUGUAGUCUCGUUUA Santa Cruz, goat pAb (N‐16) WAVE2‐2 † UAUCAUUGGAGGCGGAGGUGGCGGA AUAGUAACCUCCGCCUCCACCGCCU Chemicon, rabbit pAb (AB4226) WAVE2‐3 † AUCAGGGUGAGGUGGGAAAGAUGGG UAGUCCCACUCCACCCUUUCUACCC Chemicon, rabbit pAb (AB4226) Control GACGUGAAACCGAAGAACGTT TTCUGCAGUUUGGCUUCUUGC Open in a separate window † Invitrogen stealth siRNA.

Techniques: Transfection, Cell Culture, Extraction, Western Blot, Expressing

Figure 3. Analysis of WAVE1, WAVE2, and WAVE3 protein levels. Western analysis was performed on 50 g of protein extracted from the cerebral cortex and hippocampus of wild- type(Wt)miceaswellasfrommiceheterozygous(Het)andhomozygous(KO)forthegene-trap insertion (n 3). The analysis was performed using an anti-WAVE1 polyclonal primary anti- body (A), an anti-WAVE2 polyclonal primary antibody (B), and an anti-WAVE3 polyclonal pri- maryantibody(C).Allblotswerenormalizedbyreprobingwithananti-actinprimaryantibody. Error bars indicate SEM.

Journal: The Journal of Neuroscience

Article Title: Characterization of the WAVE1 Knock-Out Mouse: Implications for CNS Development

doi: 10.1523/jneurosci.23-08-03343.2003

Figure Lengend Snippet: Figure 3. Analysis of WAVE1, WAVE2, and WAVE3 protein levels. Western analysis was performed on 50 g of protein extracted from the cerebral cortex and hippocampus of wild- type(Wt)miceaswellasfrommiceheterozygous(Het)andhomozygous(KO)forthegene-trap insertion (n 3). The analysis was performed using an anti-WAVE1 polyclonal primary anti- body (A), an anti-WAVE2 polyclonal primary antibody (B), and an anti-WAVE3 polyclonal pri- maryantibody(C).Allblotswerenormalizedbyreprobingwithananti-actinprimaryantibody. Error bars indicate SEM.

Article Snippet: The membranes were incubated in a 1:1000 dilution of an anti-WAVE1 polyclonal antibody, a 1:200 dilution of an anti-WAVE2 polyclonal antibody (Santa Cruz Biotechnology), or a 1:200 dilution of an anti-WAVE3 polyclonal antibody (Santa Cruz Biotechnology) overnight at 4°C.

Techniques: Western Blot

Effects of SKAP2 RNAi on ARP2 and WAVE2 expression. (A) Subcellular localization of ARP2 after SKAP2 siRNA injection. ARP2 was mainly distributed at the membrane in the control oocytes, whereas ARP2 expression was barely detectable in the siRNA-injected group. Green: ARP2; blue: chromatin. Bar = 20 μm. (B) Localization of WAVE2 after SKAP2 siRNA injection. WAVE2 was expressed around the spindle, whereas no specific localization of WAVE2 was observed around spindle in the siRNA-injected group. Red: WAVE2; blue: chromatin. Bar = 20 μm. (C) The fluorescence intensity of ARP2 in the SKAP2 siRNA-injected oocytes was decreased. (D) The fluorescence intensity of WAVE2 in SKAP2 siRNA-injected oocytes was significantly reduced. (E) ARP2 expression was reduced after SKAP2 siRNA injection by western blotting examination, as the relative intensity of ARP2 protein was significantly decreased. (F) WAVE2 expression was decreased after SKAP2 siRNA injection by western blotting analysis, as the relative intensity of WAVE2 protein was significantly reduced. *: significant difference (P < 0.05).

Journal: Cell Cycle

Article Title: SKAP2 regulates Arp2/3 complex for actin-mediated asymmetric cytokinesis by interacting with WAVE2 in mouse oocytes

doi: 10.1080/15384101.2017.1380126

Figure Lengend Snippet: Effects of SKAP2 RNAi on ARP2 and WAVE2 expression. (A) Subcellular localization of ARP2 after SKAP2 siRNA injection. ARP2 was mainly distributed at the membrane in the control oocytes, whereas ARP2 expression was barely detectable in the siRNA-injected group. Green: ARP2; blue: chromatin. Bar = 20 μm. (B) Localization of WAVE2 after SKAP2 siRNA injection. WAVE2 was expressed around the spindle, whereas no specific localization of WAVE2 was observed around spindle in the siRNA-injected group. Red: WAVE2; blue: chromatin. Bar = 20 μm. (C) The fluorescence intensity of ARP2 in the SKAP2 siRNA-injected oocytes was decreased. (D) The fluorescence intensity of WAVE2 in SKAP2 siRNA-injected oocytes was significantly reduced. (E) ARP2 expression was reduced after SKAP2 siRNA injection by western blotting examination, as the relative intensity of ARP2 protein was significantly decreased. (F) WAVE2 expression was decreased after SKAP2 siRNA injection by western blotting analysis, as the relative intensity of WAVE2 protein was significantly reduced. *: significant difference (P < 0.05).

Article Snippet: Rabbit polyclonal anti-WAVE2 antibody (Cat#: 3659) was from Santa Cruz (Santa Cruz, CA, USA).

Techniques: Expressing, Injection, Fluorescence, Western Blot

FIGURE 1. Dysbindin-1A and -1C have distinct spatial and temporal expression patterns and dysbindin-1C is not a subunit of the BLOC-1 complex. Tissue extracts from DBA/2J mice were subjected to SDS-PAGE followed by Western blotting using anti-dysbindin-1 antibody. The brain extract from sdy was used as a negative control, and -actin was used as a loading control. These experiments were repeated three times independently. A, dysbindin-1A is widely expressed in multiple mouse tissues, whereas dysbindin-1C is only expressed in the brain and spinal cord. B, in brain sub-regions, the dysbindin-1A levels are higher than dysbindin-1C in the olfactory bulb, substantia nigra, cerebellar cortex, and brain stem, but dysbindin-1C has higher expression levels than dysbindin-1A in the striatum, cerebral cortex, and hippocampal formation. C, dysbindin-1C is mainly enriched in the synaptic vesicles, whereas dysbindin-1A is mainly localized in the presynaptic membrane. In addition, both dysbindin-1A and -1C are found in the proportion of postsynaptic density. Successful synaptic fractionation is confirmed with VAMP2 as a marker for synaptic vesicles and GluR1 as a marker for the postsynaptic density. D and E, protein levels of dysbindin-1A in the hippocampal formation are gradually decreased. In contrast, the dysbindin-1C expression levels increase at postnatal stages. The chart in E is plotted by the relative intensities (IOD) of the bands in D. F, sedimentation velocity analyses. Mouse brain cytosol was fractioned by ultracentrifugation on a 5–20% (w/v) sucrose gradient and probed with antibodies against dysbindin-1, BLOS1, -dystrobrevin, and WAVE2 by immunoblotting. Fractions 1 and 20 correspond to the top and bottom ends of the gradient, respectively. Dysbindin-1C does not co-sediment with subunits of the BLOC-1 complex, including dysbindin-1A and BLOS1. Moreover, dysbindin-1C does not form a stable DPC complex with -dystrobrevin nor a stable ternary complex with WAVE2 and Abi-1. Arrowheads, nonspecific bands. G, destabilization of the dysbindin-1 in extracts of three BLOC-1 mutants (sdy, pa, and mu). Sdy is the mutant of dysbindin-1; mu is the mutant of muted; and pa is the mutant of pallidin. Inbred strain DBA/2J served as the control for sdy, CHMU/Le for mu, and C57BL/6J for pa.

Journal: Journal of Biological Chemistry

Article Title: Dysbindin-1C Is Required for the Survival of Hilar Mossy Cells and the Maturation of Adult Newborn Neurons in Dentate Gyrus

doi: 10.1074/jbc.m114.590927

Figure Lengend Snippet: FIGURE 1. Dysbindin-1A and -1C have distinct spatial and temporal expression patterns and dysbindin-1C is not a subunit of the BLOC-1 complex. Tissue extracts from DBA/2J mice were subjected to SDS-PAGE followed by Western blotting using anti-dysbindin-1 antibody. The brain extract from sdy was used as a negative control, and -actin was used as a loading control. These experiments were repeated three times independently. A, dysbindin-1A is widely expressed in multiple mouse tissues, whereas dysbindin-1C is only expressed in the brain and spinal cord. B, in brain sub-regions, the dysbindin-1A levels are higher than dysbindin-1C in the olfactory bulb, substantia nigra, cerebellar cortex, and brain stem, but dysbindin-1C has higher expression levels than dysbindin-1A in the striatum, cerebral cortex, and hippocampal formation. C, dysbindin-1C is mainly enriched in the synaptic vesicles, whereas dysbindin-1A is mainly localized in the presynaptic membrane. In addition, both dysbindin-1A and -1C are found in the proportion of postsynaptic density. Successful synaptic fractionation is confirmed with VAMP2 as a marker for synaptic vesicles and GluR1 as a marker for the postsynaptic density. D and E, protein levels of dysbindin-1A in the hippocampal formation are gradually decreased. In contrast, the dysbindin-1C expression levels increase at postnatal stages. The chart in E is plotted by the relative intensities (IOD) of the bands in D. F, sedimentation velocity analyses. Mouse brain cytosol was fractioned by ultracentrifugation on a 5–20% (w/v) sucrose gradient and probed with antibodies against dysbindin-1, BLOS1, -dystrobrevin, and WAVE2 by immunoblotting. Fractions 1 and 20 correspond to the top and bottom ends of the gradient, respectively. Dysbindin-1C does not co-sediment with subunits of the BLOC-1 complex, including dysbindin-1A and BLOS1. Moreover, dysbindin-1C does not form a stable DPC complex with -dystrobrevin nor a stable ternary complex with WAVE2 and Abi-1. Arrowheads, nonspecific bands. G, destabilization of the dysbindin-1 in extracts of three BLOC-1 mutants (sdy, pa, and mu). Sdy is the mutant of dysbindin-1; mu is the mutant of muted; and pa is the mutant of pallidin. Inbred strain DBA/2J served as the control for sdy, CHMU/Le for mu, and C57BL/6J for pa.

Article Snippet: Other antibodies used in this study were as follows: goat anti-WAVE2 polyclonal antibody (WB, 1:1000, sc-10394, Santa Cruz Biotechnology, Dallas, TX); goat anti- - dystrobrevin polyclonal antibody (WB, 1:200, sc-13815, Santa Cruz Biotechnology); mouse anti- -actin monoclonal antibody (WB, 1:10,000, A5441, Sigma); goat anti-Sox2 polyclonal antibody (IF, 1:1000, sc-17320, Santa Cruz Biotechnology); mouse anti-nestin monoclonal antibody (IF, 1:100, MAB353, Millipore, Billerica, MA); mouse anti-GFAP monoclonal antibody (IF, 1:1000, IF03L, Millipore); mouse anti-GAD67 monoclonal antibody (IF, 1:100, MAB5406, Millipore); mouse anti-calretinin monoclonal antibody (IF, 1:1000, MAB1568, Millipore); rat anti-BrdU monoclonal antibody (IF, 1:100, ab6326, Abcam, Cambridge, UK); goat anti-DCX polyclonal antibody (IF, 1:150, sc-8066, Santa Cruz Biotechnology); mouse anti-NeuN monoclonal antibody (IF, 1:800, MAB377, Millipore); rabbit antiS100 polyclonal antibody (IF, 1:1000, ab868, Abcam); rabbit anti-phospho-CREB (Ser133) polyclonal antibody (IF, 1:200, 9198, Cell Signaling Technology, Danvers, MA), monoclonal mouse anti-Flag antibody (WB, 1:5000, Sigma); and secondary antibody Alexa Fluor 408, 488, or 594 IgG (1:2000, Molecular Probes, Eugene, OR).

Techniques: Expressing, SDS Page, Western Blot, Negative Control, Control, Membrane, Fractionation, Marker, Sedimentation, Mutagenesis

Journal: iScience

Article Title: WASH interacts with Ku to regulate DNA double-stranded break repair

doi: 10.1016/j.isci.2021.103676

Figure Lengend Snippet:

Article Snippet: Rabbit polyclonal anti-WAVE2 , Abbkine , Cat#ABP53432.

Techniques: Recombinant, In Situ, Plasmid Preparation, Expressing, Construct, Software

WAVE2 contributes to the ability of B cells to spread on immobilized anti-Ig. ( A ) A20 B-lymphoma cells and primary B cells were transfected with control siRNA or WAVE2 siRNA and analyzed via immunoblotting with Abs to WAVE2 or actin. WAVE2 band intensities were normalized to the actin loading control for the same sample and expressed relative to values for control siRNA-transfected cells. Full uncropped blots are shown in . ( B – D ) A20 cells were transfected with control siRNA or WAVE2 siRNA (WAVE2 KD) or pre-treated for 1 h with 100 µM CK-666. The cells were added to coverslips coated with 2.4 μg/cm 2 anti-IgG for the indicated times and then stained with rhodamine-phalloidin to visualize F-actin. Representative images are shown in panel ( B ). Scale bars: 10 µm. Cell areas were quantified using ImageJ version 10.9.0. Panel ( C ) shows one of three independent experiments with similar results. Each dot is one cell, and the medians and interquartile ranges are shown for >25 cells per condition. p -values were calculated using the Mann–Whitney U test. Panel D shows combined data from 3 independent experiments. Each symbol is an individual experiment and the data are presented as the mean ± SEM for the median values from the 3 experiments. p -values were calculated using two-tailed paired t -tests. ( E – G ) Control siRNA- and WAVE2 siRNA-transfected A20 cells were added to coverslips that had been coated with 2.4 μg/cm 2 anti-IgG for the indicated times and then stained with rhodamine-phalloidin. The data are presented as in panels ( B – D ). ( H – J ) Primary B cells transfected with control siRNA or WAVE2 siRNA (WAVE2 KD) were added to coverslips coated with 2.4 μg/cm 2 anti-IgM for the indicated times and then stained with rhodamine-phalloidin. The data are presented as in panels ( B – D ). All scale bars are 10 µm.

Journal: Cells

Article Title: WAVE2 Regulates Actin-Dependent Processes Induced by the B Cell Antigen Receptor and Integrins

doi: 10.3390/cells12232704

Figure Lengend Snippet: WAVE2 contributes to the ability of B cells to spread on immobilized anti-Ig. ( A ) A20 B-lymphoma cells and primary B cells were transfected with control siRNA or WAVE2 siRNA and analyzed via immunoblotting with Abs to WAVE2 or actin. WAVE2 band intensities were normalized to the actin loading control for the same sample and expressed relative to values for control siRNA-transfected cells. Full uncropped blots are shown in . ( B – D ) A20 cells were transfected with control siRNA or WAVE2 siRNA (WAVE2 KD) or pre-treated for 1 h with 100 µM CK-666. The cells were added to coverslips coated with 2.4 μg/cm 2 anti-IgG for the indicated times and then stained with rhodamine-phalloidin to visualize F-actin. Representative images are shown in panel ( B ). Scale bars: 10 µm. Cell areas were quantified using ImageJ version 10.9.0. Panel ( C ) shows one of three independent experiments with similar results. Each dot is one cell, and the medians and interquartile ranges are shown for >25 cells per condition. p -values were calculated using the Mann–Whitney U test. Panel D shows combined data from 3 independent experiments. Each symbol is an individual experiment and the data are presented as the mean ± SEM for the median values from the 3 experiments. p -values were calculated using two-tailed paired t -tests. ( E – G ) Control siRNA- and WAVE2 siRNA-transfected A20 cells were added to coverslips that had been coated with 2.4 μg/cm 2 anti-IgG for the indicated times and then stained with rhodamine-phalloidin. The data are presented as in panels ( B – D ). ( H – J ) Primary B cells transfected with control siRNA or WAVE2 siRNA (WAVE2 KD) were added to coverslips coated with 2.4 μg/cm 2 anti-IgM for the indicated times and then stained with rhodamine-phalloidin. The data are presented as in panels ( B – D ). All scale bars are 10 µm.

Article Snippet: The membranes were blocked with 5% milk powder in Tris-buffered saline (10 mM of Tris-HCl, pH 8, and 150 of mM NaCl) and then incubated overnight at 4 °C with rabbit Abs to WAVE2 (Thermo Fisher, Waltham, MA, USA #PA5-60975, 1:200 dilution), phosphorylated CD79a (pCD79a; Cell Signaling Technologies, Danvers, MA, USA #5173, 1:1000), CD79a ([ ]; 1:5000), phospho-ERK (pERK; Cell Signaling Technologies, Danvers, MA, USA #9101, 1:1000), ERK (Cell Signaling Technologies, Danvers, MA, USA #9102; 1:1000), phospho-Akt S473 (pAkt; Cell Signaling Technologies, Danvers, MA, USA #9271; 1:1000), Akt (Cell Signaling Technologies, Danvers, MA, USA #9272; 1:1000), or NCKAP1L/Hem1 (Thermo Fisher, Waltham, MA, USA #PA5-58813; 1:500).

Techniques: Transfection, Control, Western Blot, Staining, MANN-WHITNEY, Two Tailed Test

WAVE2 KD does not reduce the expression of Hem1 protein and does not affect BCR signaling in response to immobilized anti-Ig. ( A ) A20 cells were transfected with control siRNA or WAVE2 siRNA, cultured for 48 h, and then analyzed via immunoblotting with Abs to WAVE2, Hem1, or actin (loading control). Normalized levels of WAVE2 or Hem1 relative to control siRNA-transfected cells are shown. ( B ) A20 cells that had been transfected with control siRNA or WAVE2 siRNA were allowed to spread on anti-IgG-coated tissue culture wells for the indicated times before analyzing BCR signaling by immunoblotting for the phosphorylation of the CD79a ITAM (pCD79a) or the phosphorylated (activated) forms of ERK (pERK) or Akt (pAkt). The same cell lysates were probed for total CD79a, ERK, or Akt. The dashed red line was overlaid on the images of the blots to visually separate the time courses for the control siRNA and WAVE2 siRNA-transfected cells. For both panels, one of three independent experiments with similar results is shown. Full uncropped blots are shown in .

Journal: Cells

Article Title: WAVE2 Regulates Actin-Dependent Processes Induced by the B Cell Antigen Receptor and Integrins

doi: 10.3390/cells12232704

Figure Lengend Snippet: WAVE2 KD does not reduce the expression of Hem1 protein and does not affect BCR signaling in response to immobilized anti-Ig. ( A ) A20 cells were transfected with control siRNA or WAVE2 siRNA, cultured for 48 h, and then analyzed via immunoblotting with Abs to WAVE2, Hem1, or actin (loading control). Normalized levels of WAVE2 or Hem1 relative to control siRNA-transfected cells are shown. ( B ) A20 cells that had been transfected with control siRNA or WAVE2 siRNA were allowed to spread on anti-IgG-coated tissue culture wells for the indicated times before analyzing BCR signaling by immunoblotting for the phosphorylation of the CD79a ITAM (pCD79a) or the phosphorylated (activated) forms of ERK (pERK) or Akt (pAkt). The same cell lysates were probed for total CD79a, ERK, or Akt. The dashed red line was overlaid on the images of the blots to visually separate the time courses for the control siRNA and WAVE2 siRNA-transfected cells. For both panels, one of three independent experiments with similar results is shown. Full uncropped blots are shown in .

Article Snippet: The membranes were blocked with 5% milk powder in Tris-buffered saline (10 mM of Tris-HCl, pH 8, and 150 of mM NaCl) and then incubated overnight at 4 °C with rabbit Abs to WAVE2 (Thermo Fisher, Waltham, MA, USA #PA5-60975, 1:200 dilution), phosphorylated CD79a (pCD79a; Cell Signaling Technologies, Danvers, MA, USA #5173, 1:1000), CD79a ([ ]; 1:5000), phospho-ERK (pERK; Cell Signaling Technologies, Danvers, MA, USA #9101, 1:1000), ERK (Cell Signaling Technologies, Danvers, MA, USA #9102; 1:1000), phospho-Akt S473 (pAkt; Cell Signaling Technologies, Danvers, MA, USA #9271; 1:1000), Akt (Cell Signaling Technologies, Danvers, MA, USA #9272; 1:1000), or NCKAP1L/Hem1 (Thermo Fisher, Waltham, MA, USA #PA5-58813; 1:500).

Techniques: Expressing, Transfection, Control, Cell Culture, Western Blot, Phospho-proteomics

WAVE2 localizes to the peripheral actin ring in spreading B cells. ( A , B ) A20 cells were allowed to spread for 30 min on coverslips coated with 2.4 μg/cm 2 anti-Ig G. The cells were stained for F-actin and WAVE2 and then imaged via STED microscopy ( A ). Scale bar: 5 µm. Panel ( B ) shows F-actin and WAVE2 fluorescence intensity profiles along the yellow lines in panel ( A ). ( C , D ) Primary murine B cells that had been cultured overnight with IL-4 or with IL-4 + LPS were allowed to spread for 30 min on coverslips coated with 2.4 μg/cm 2 anti-IgM. The cells were stained for F-actin and WAVE2 and imaged via confocal microscopy. Enlarged images of the cells indicated by the yellow boxes on the merge panels are shown to the right. Scale bars: 10 µm. Panel ( D ) shows F-actin and WAVE2 fluorescence intensity profiles along the yellow lines in the enlarged cell images in panel ( C ). In the plot profiles in panels ( B , D ), the grey lines represent F-actin fluorescence intensity and the purple lines represent WAVE2 fluorescence intensity.

Journal: Cells

Article Title: WAVE2 Regulates Actin-Dependent Processes Induced by the B Cell Antigen Receptor and Integrins

doi: 10.3390/cells12232704

Figure Lengend Snippet: WAVE2 localizes to the peripheral actin ring in spreading B cells. ( A , B ) A20 cells were allowed to spread for 30 min on coverslips coated with 2.4 μg/cm 2 anti-Ig G. The cells were stained for F-actin and WAVE2 and then imaged via STED microscopy ( A ). Scale bar: 5 µm. Panel ( B ) shows F-actin and WAVE2 fluorescence intensity profiles along the yellow lines in panel ( A ). ( C , D ) Primary murine B cells that had been cultured overnight with IL-4 or with IL-4 + LPS were allowed to spread for 30 min on coverslips coated with 2.4 μg/cm 2 anti-IgM. The cells were stained for F-actin and WAVE2 and imaged via confocal microscopy. Enlarged images of the cells indicated by the yellow boxes on the merge panels are shown to the right. Scale bars: 10 µm. Panel ( D ) shows F-actin and WAVE2 fluorescence intensity profiles along the yellow lines in the enlarged cell images in panel ( C ). In the plot profiles in panels ( B , D ), the grey lines represent F-actin fluorescence intensity and the purple lines represent WAVE2 fluorescence intensity.

Article Snippet: The membranes were blocked with 5% milk powder in Tris-buffered saline (10 mM of Tris-HCl, pH 8, and 150 of mM NaCl) and then incubated overnight at 4 °C with rabbit Abs to WAVE2 (Thermo Fisher, Waltham, MA, USA #PA5-60975, 1:200 dilution), phosphorylated CD79a (pCD79a; Cell Signaling Technologies, Danvers, MA, USA #5173, 1:1000), CD79a ([ ]; 1:5000), phospho-ERK (pERK; Cell Signaling Technologies, Danvers, MA, USA #9101, 1:1000), ERK (Cell Signaling Technologies, Danvers, MA, USA #9102; 1:1000), phospho-Akt S473 (pAkt; Cell Signaling Technologies, Danvers, MA, USA #9271; 1:1000), Akt (Cell Signaling Technologies, Danvers, MA, USA #9272; 1:1000), or NCKAP1L/Hem1 (Thermo Fisher, Waltham, MA, USA #PA5-58813; 1:500).

Techniques: Staining, Microscopy, Fluorescence, Cell Culture, Confocal Microscopy

WAVE2 contributes to peripheral F-actin assembly and actin retrograde flow. ( A ) Control siRNA- and WAVE2 siRNA-transfected A20 cells were allowed to spread on anti-IgG-coated coverslips for 15 or 30 min before being stained for F-actin and imaged via STED microscopy. Scale bar: 5 µm. ( B , C ) Confocal microscopy images of the control siRNA- and WAVE2 siRNA-transfected A20 cells from the experiments in B–D were used to calculate the average peripheral actin ring thickness for each cell, as described in the Methods section. Panel ( B ) shows representative data from a single experiment with the median and interquartile range for >20 cells per condition. p -values were calculated using the Mann–Whitney U test. Panel ( C ) shows the mean ± SEM for the median values from 3 independent experiments. p -values were calculated using two-tailed paired t -tests. ( D , E ) A20 cells that had been co-transfected with F-tractin-GFP and either control siRNA or WAVE2 siRNA were allowed to spread for 10 min on coverslips coated with 2.4 μg/cm 2 anti-IgG before initiating live-cell confocal microscopy imaging. Images were acquired at 1 s intervals for 2 min. In panel ( D ), representative kymographs along the yellow lines in the top panels (Scale bar: 10 µm) are shown in the bottom panels. The centripetal velocity (Δx/Δt) was calculated for individual actin tracks on the kymographs. Panel ( E ) shows two independent experiments in which the actin retrograde flow velocity was calculated for >10 tracks per cell for 3–6 cells. Each dot is one track. Medians and interquartile ranges are shown. The Mann–Whitney U test was used to calculate p -values.

Journal: Cells

Article Title: WAVE2 Regulates Actin-Dependent Processes Induced by the B Cell Antigen Receptor and Integrins

doi: 10.3390/cells12232704

Figure Lengend Snippet: WAVE2 contributes to peripheral F-actin assembly and actin retrograde flow. ( A ) Control siRNA- and WAVE2 siRNA-transfected A20 cells were allowed to spread on anti-IgG-coated coverslips for 15 or 30 min before being stained for F-actin and imaged via STED microscopy. Scale bar: 5 µm. ( B , C ) Confocal microscopy images of the control siRNA- and WAVE2 siRNA-transfected A20 cells from the experiments in B–D were used to calculate the average peripheral actin ring thickness for each cell, as described in the Methods section. Panel ( B ) shows representative data from a single experiment with the median and interquartile range for >20 cells per condition. p -values were calculated using the Mann–Whitney U test. Panel ( C ) shows the mean ± SEM for the median values from 3 independent experiments. p -values were calculated using two-tailed paired t -tests. ( D , E ) A20 cells that had been co-transfected with F-tractin-GFP and either control siRNA or WAVE2 siRNA were allowed to spread for 10 min on coverslips coated with 2.4 μg/cm 2 anti-IgG before initiating live-cell confocal microscopy imaging. Images were acquired at 1 s intervals for 2 min. In panel ( D ), representative kymographs along the yellow lines in the top panels (Scale bar: 10 µm) are shown in the bottom panels. The centripetal velocity (Δx/Δt) was calculated for individual actin tracks on the kymographs. Panel ( E ) shows two independent experiments in which the actin retrograde flow velocity was calculated for >10 tracks per cell for 3–6 cells. Each dot is one track. Medians and interquartile ranges are shown. The Mann–Whitney U test was used to calculate p -values.

Article Snippet: The membranes were blocked with 5% milk powder in Tris-buffered saline (10 mM of Tris-HCl, pH 8, and 150 of mM NaCl) and then incubated overnight at 4 °C with rabbit Abs to WAVE2 (Thermo Fisher, Waltham, MA, USA #PA5-60975, 1:200 dilution), phosphorylated CD79a (pCD79a; Cell Signaling Technologies, Danvers, MA, USA #5173, 1:1000), CD79a ([ ]; 1:5000), phospho-ERK (pERK; Cell Signaling Technologies, Danvers, MA, USA #9101, 1:1000), ERK (Cell Signaling Technologies, Danvers, MA, USA #9102; 1:1000), phospho-Akt S473 (pAkt; Cell Signaling Technologies, Danvers, MA, USA #9271; 1:1000), Akt (Cell Signaling Technologies, Danvers, MA, USA #9272; 1:1000), or NCKAP1L/Hem1 (Thermo Fisher, Waltham, MA, USA #PA5-58813; 1:500).

Techniques: Control, Transfection, Staining, Microscopy, Confocal Microscopy, MANN-WHITNEY, Two Tailed Test, Imaging

WAVE2 KD does not reduce recruitment of the Arp2/3 complex to actin structures. Control siRNA- and WAVE2 siRNA-transfected A20 cells were allowed to spread on anti-IgG-coated coverslips for 15 or 30 min. The cells were stained for F-actin and the p34/ARPC2 subunit of the Arp2/3 complex and imaged via confocal microscopy ( A ) Representative images. Scale bars: 10 µm. ( B ) The confocal images were used to determine the Manders’ coefficient for the fraction of p34/ARPC2 that co-localized with F-actin. Super-plot showing combined data from 2 independent experiments for >25 cells per condition. Each dot is one cell and the different colors represent the two independent experiments. The large symbols represent the median values for each experiment. p -values for control cells versus WAVE2 KD cells in the combined experiments were calculated using the Mann–Whitney U test.

Journal: Cells

Article Title: WAVE2 Regulates Actin-Dependent Processes Induced by the B Cell Antigen Receptor and Integrins

doi: 10.3390/cells12232704

Figure Lengend Snippet: WAVE2 KD does not reduce recruitment of the Arp2/3 complex to actin structures. Control siRNA- and WAVE2 siRNA-transfected A20 cells were allowed to spread on anti-IgG-coated coverslips for 15 or 30 min. The cells were stained for F-actin and the p34/ARPC2 subunit of the Arp2/3 complex and imaged via confocal microscopy ( A ) Representative images. Scale bars: 10 µm. ( B ) The confocal images were used to determine the Manders’ coefficient for the fraction of p34/ARPC2 that co-localized with F-actin. Super-plot showing combined data from 2 independent experiments for >25 cells per condition. Each dot is one cell and the different colors represent the two independent experiments. The large symbols represent the median values for each experiment. p -values for control cells versus WAVE2 KD cells in the combined experiments were calculated using the Mann–Whitney U test.

Article Snippet: The membranes were blocked with 5% milk powder in Tris-buffered saline (10 mM of Tris-HCl, pH 8, and 150 of mM NaCl) and then incubated overnight at 4 °C with rabbit Abs to WAVE2 (Thermo Fisher, Waltham, MA, USA #PA5-60975, 1:200 dilution), phosphorylated CD79a (pCD79a; Cell Signaling Technologies, Danvers, MA, USA #5173, 1:1000), CD79a ([ ]; 1:5000), phospho-ERK (pERK; Cell Signaling Technologies, Danvers, MA, USA #9101, 1:1000), ERK (Cell Signaling Technologies, Danvers, MA, USA #9102; 1:1000), phospho-Akt S473 (pAkt; Cell Signaling Technologies, Danvers, MA, USA #9271; 1:1000), Akt (Cell Signaling Technologies, Danvers, MA, USA #9272; 1:1000), or NCKAP1L/Hem1 (Thermo Fisher, Waltham, MA, USA #PA5-58813; 1:500).

Techniques: Control, Transfection, Staining, Confocal Microscopy, MANN-WHITNEY

WAVE2 contributes to the LFA-1-dependent formation of actomyosin arcs. ( A ) A20 cells were allowed to spread for 10 or 30 min on coverslips coated with a suboptimal density of anti-IgG (0.625 µg/cm 2 ), ICAM-1 (0.15 µg/cm 2 ), or 0.625 µg/cm 2 anti-IgG plus 0.15 µg/cm 2 ICAM-1. The cells were stained for F-actin and cell areas were quantified from confocal microscopy images. Medians and interquartile ranges are shown for >25 cells per condition. p -values were calculated using the Mann–Whitney U test. ( B ) Control and WAVE2 KD A20 cells were allowed to spread for 30 min on coverslips coated with a low density of anti-IgG (0.625 µg/cm 2 ) with or without 0.15 µg/cm 2 ICAM-1. The means ± SEM for the median values from 3 independent experiments are shown. p -values were calculated using two-tailed paired t -tests. ( C ) A20 cells that had been transfected with a plasmid encoding myosin IIA-GFP were allowed to spread for 30 min on coverslips that had been coated with 2.4 µg/cm 2 anti-IgG (high anti-IgG) or 0.625 µg/cm 2 anti-IgG (low anti-IgG) plus 0.15 µg/cm 2 ICAM-1. Representative images are shown. Scale bar: 10 µm. ( D , E ) Control siRNA- and WAVE2 siRNA-transfected A20 cells were allowed to spread for 30 min on coverslips that had been coated with 2.4 µg/cm 2 anti-IgG (high anti-IgG) or 0.625 µg/cm 2 anti-IgG (low anti-IgG) plus 0.15 µg/cm 2 ICAM-1. Cells were stained for F-actin and imaged by STED microscopy. Representative images are shown, and the yellow arrowheads indicate actin arcs ( D ). For comparison, examples are shown of WAVE2 KD cells that did or did not form actin arcs when plated on low anti-IgG plus ICAM-1. Scale bar: 5 µm. In panel ( E ), the percent of cells that formed distinct actin arcs was determined in 3 independent experiments (n > 30 cells per condition). The data are presented as the mean ± SEM for the 3 experiments. p -values were calculated using two-tailed paired t -tests.

Journal: Cells

Article Title: WAVE2 Regulates Actin-Dependent Processes Induced by the B Cell Antigen Receptor and Integrins

doi: 10.3390/cells12232704

Figure Lengend Snippet: WAVE2 contributes to the LFA-1-dependent formation of actomyosin arcs. ( A ) A20 cells were allowed to spread for 10 or 30 min on coverslips coated with a suboptimal density of anti-IgG (0.625 µg/cm 2 ), ICAM-1 (0.15 µg/cm 2 ), or 0.625 µg/cm 2 anti-IgG plus 0.15 µg/cm 2 ICAM-1. The cells were stained for F-actin and cell areas were quantified from confocal microscopy images. Medians and interquartile ranges are shown for >25 cells per condition. p -values were calculated using the Mann–Whitney U test. ( B ) Control and WAVE2 KD A20 cells were allowed to spread for 30 min on coverslips coated with a low density of anti-IgG (0.625 µg/cm 2 ) with or without 0.15 µg/cm 2 ICAM-1. The means ± SEM for the median values from 3 independent experiments are shown. p -values were calculated using two-tailed paired t -tests. ( C ) A20 cells that had been transfected with a plasmid encoding myosin IIA-GFP were allowed to spread for 30 min on coverslips that had been coated with 2.4 µg/cm 2 anti-IgG (high anti-IgG) or 0.625 µg/cm 2 anti-IgG (low anti-IgG) plus 0.15 µg/cm 2 ICAM-1. Representative images are shown. Scale bar: 10 µm. ( D , E ) Control siRNA- and WAVE2 siRNA-transfected A20 cells were allowed to spread for 30 min on coverslips that had been coated with 2.4 µg/cm 2 anti-IgG (high anti-IgG) or 0.625 µg/cm 2 anti-IgG (low anti-IgG) plus 0.15 µg/cm 2 ICAM-1. Cells were stained for F-actin and imaged by STED microscopy. Representative images are shown, and the yellow arrowheads indicate actin arcs ( D ). For comparison, examples are shown of WAVE2 KD cells that did or did not form actin arcs when plated on low anti-IgG plus ICAM-1. Scale bar: 5 µm. In panel ( E ), the percent of cells that formed distinct actin arcs was determined in 3 independent experiments (n > 30 cells per condition). The data are presented as the mean ± SEM for the 3 experiments. p -values were calculated using two-tailed paired t -tests.

Article Snippet: The membranes were blocked with 5% milk powder in Tris-buffered saline (10 mM of Tris-HCl, pH 8, and 150 of mM NaCl) and then incubated overnight at 4 °C with rabbit Abs to WAVE2 (Thermo Fisher, Waltham, MA, USA #PA5-60975, 1:200 dilution), phosphorylated CD79a (pCD79a; Cell Signaling Technologies, Danvers, MA, USA #5173, 1:1000), CD79a ([ ]; 1:5000), phospho-ERK (pERK; Cell Signaling Technologies, Danvers, MA, USA #9101, 1:1000), ERK (Cell Signaling Technologies, Danvers, MA, USA #9102; 1:1000), phospho-Akt S473 (pAkt; Cell Signaling Technologies, Danvers, MA, USA #9271; 1:1000), Akt (Cell Signaling Technologies, Danvers, MA, USA #9272; 1:1000), or NCKAP1L/Hem1 (Thermo Fisher, Waltham, MA, USA #PA5-58813; 1:500).

Techniques: Staining, Confocal Microscopy, MANN-WHITNEY, Control, Two Tailed Test, Transfection, Plasmid Preparation, Microscopy, Comparison

WAVE2 contributes to the ability of B cells to spread on FN. ( A , B ) A20 cells that had been transfected with either control siRNA or WAVE2 siRNA, or pre-treated for 1 h with 100 µM CK-666, were added to FN-coated coverslips. After the indicated times the cells were fixed, stained with rhodamine-phalloidin, and imaged via confocal microscopy (( A ) scale bar: 10 µm) or STED microscopy (( B ) scale bar: 5 µm). Representative images are shown. ( C , D ) In each experiment, cell areas were quantified from confocal microscopy images for >30 cells per condition. A single representative experiment ( C ) as well as combined data from 3 independent experiments ( D ) are shown. The data are presented in as . In panel ( D ), p -values were calculated for the control cells versus WAVE2 KD cells using two-tailed paired t -tests. Where no error bars were visible, they were smaller than the symbols.

Journal: Cells

Article Title: WAVE2 Regulates Actin-Dependent Processes Induced by the B Cell Antigen Receptor and Integrins

doi: 10.3390/cells12232704

Figure Lengend Snippet: WAVE2 contributes to the ability of B cells to spread on FN. ( A , B ) A20 cells that had been transfected with either control siRNA or WAVE2 siRNA, or pre-treated for 1 h with 100 µM CK-666, were added to FN-coated coverslips. After the indicated times the cells were fixed, stained with rhodamine-phalloidin, and imaged via confocal microscopy (( A ) scale bar: 10 µm) or STED microscopy (( B ) scale bar: 5 µm). Representative images are shown. ( C , D ) In each experiment, cell areas were quantified from confocal microscopy images for >30 cells per condition. A single representative experiment ( C ) as well as combined data from 3 independent experiments ( D ) are shown. The data are presented in as . In panel ( D ), p -values were calculated for the control cells versus WAVE2 KD cells using two-tailed paired t -tests. Where no error bars were visible, they were smaller than the symbols.

Article Snippet: The membranes were blocked with 5% milk powder in Tris-buffered saline (10 mM of Tris-HCl, pH 8, and 150 of mM NaCl) and then incubated overnight at 4 °C with rabbit Abs to WAVE2 (Thermo Fisher, Waltham, MA, USA #PA5-60975, 1:200 dilution), phosphorylated CD79a (pCD79a; Cell Signaling Technologies, Danvers, MA, USA #5173, 1:1000), CD79a ([ ]; 1:5000), phospho-ERK (pERK; Cell Signaling Technologies, Danvers, MA, USA #9101, 1:1000), ERK (Cell Signaling Technologies, Danvers, MA, USA #9102; 1:1000), phospho-Akt S473 (pAkt; Cell Signaling Technologies, Danvers, MA, USA #9271; 1:1000), Akt (Cell Signaling Technologies, Danvers, MA, USA #9272; 1:1000), or NCKAP1L/Hem1 (Thermo Fisher, Waltham, MA, USA #PA5-58813; 1:500).

Techniques: Transfection, Control, Staining, Confocal Microscopy, Microscopy, Two Tailed Test

WAVE2 enhances APC-induced BCR signaling and signal amplification. Control siRNA- and WAVE2 siRNA-transfected A20 cells were added to COS-7 cells expressing the ani-Igκ surrogate Ag on their surface. After 5–30 min, the cells were fixed, permeabilized, and stained for pCD79 and the surrogate Ag. ( A ) Representative confocal images of clustered Ag and proximal BCR signaling (pCD79) at the B cell-COS-7 cell contact site. Scale bar: 10 µm. ( B – E ) For each B cell, the total amount of clustered pCD79 (panels B , C ) and clustered Ag were quantified for >50 cells per condition and were used to determine the ratio of clustered pCD79/clustered Ag (signal amplification; panels D , E ). Panels ( B , D ) show the data from the same representative experiment. Each dot is one cell, and the medians and interquartile ranges are shown. p -values were determined using the Mann–Whitney U test. Panels ( C , E ) show combined data from 3 independent experiments. Each red symbol is an individual experiment, and the data are presented as the mean ± SEM for the median values from the 3 experiments. p -values were calculated using two-tailed paired t -tests. In panels ( C , E ) the dashed lines represent the values for control cells, which were defined as 100%, and the areas shaded in blue highlight time points for which the values for WAVE2 KD cells were significantly different ( p < 0.005) from those for the control cells.

Journal: Cells

Article Title: WAVE2 Regulates Actin-Dependent Processes Induced by the B Cell Antigen Receptor and Integrins

doi: 10.3390/cells12232704

Figure Lengend Snippet: WAVE2 enhances APC-induced BCR signaling and signal amplification. Control siRNA- and WAVE2 siRNA-transfected A20 cells were added to COS-7 cells expressing the ani-Igκ surrogate Ag on their surface. After 5–30 min, the cells were fixed, permeabilized, and stained for pCD79 and the surrogate Ag. ( A ) Representative confocal images of clustered Ag and proximal BCR signaling (pCD79) at the B cell-COS-7 cell contact site. Scale bar: 10 µm. ( B – E ) For each B cell, the total amount of clustered pCD79 (panels B , C ) and clustered Ag were quantified for >50 cells per condition and were used to determine the ratio of clustered pCD79/clustered Ag (signal amplification; panels D , E ). Panels ( B , D ) show the data from the same representative experiment. Each dot is one cell, and the medians and interquartile ranges are shown. p -values were determined using the Mann–Whitney U test. Panels ( C , E ) show combined data from 3 independent experiments. Each red symbol is an individual experiment, and the data are presented as the mean ± SEM for the median values from the 3 experiments. p -values were calculated using two-tailed paired t -tests. In panels ( C , E ) the dashed lines represent the values for control cells, which were defined as 100%, and the areas shaded in blue highlight time points for which the values for WAVE2 KD cells were significantly different ( p < 0.005) from those for the control cells.

Article Snippet: The membranes were blocked with 5% milk powder in Tris-buffered saline (10 mM of Tris-HCl, pH 8, and 150 of mM NaCl) and then incubated overnight at 4 °C with rabbit Abs to WAVE2 (Thermo Fisher, Waltham, MA, USA #PA5-60975, 1:200 dilution), phosphorylated CD79a (pCD79a; Cell Signaling Technologies, Danvers, MA, USA #5173, 1:1000), CD79a ([ ]; 1:5000), phospho-ERK (pERK; Cell Signaling Technologies, Danvers, MA, USA #9101, 1:1000), ERK (Cell Signaling Technologies, Danvers, MA, USA #9102; 1:1000), phospho-Akt S473 (pAkt; Cell Signaling Technologies, Danvers, MA, USA #9271; 1:1000), Akt (Cell Signaling Technologies, Danvers, MA, USA #9272; 1:1000), or NCKAP1L/Hem1 (Thermo Fisher, Waltham, MA, USA #PA5-58813; 1:500).

Techniques: Amplification, Control, Transfection, Expressing, Staining, MANN-WHITNEY, Two Tailed Test

WAVE2 is important for APC-induced B cell activation. Control siRNA- and WAVE2 siRNA-transfected primary B cells, as well as primary B cells that had been treated with CK-666 for 1 h, were added to COS-7 cells expressing the anti-Igκ surrogate Ag. The cells were co-cultured overnight before being stained for CD69 and IgM and analyzed via flow cytometry. ( A ) After gating on IgM + cells, forward/side scatter (top row) was used to identify single live B cells and quantify their CD69 fluorescence (bottom row). ( B ) The surrogate APC-induced increase in cell surface CD69 levels (left panel; geometric means) and percent CD69 + cells were calculated by subtracting the values for unstimulated B cells that were cultured without anti-Igκ-expressing COS-7 cells. Each colored dot is an independent experiment. The data are presented as the mean + SEM for the 3 experiments. p -values were calculated using the One-Way repeated measures ANOVA test.

Journal: Cells

Article Title: WAVE2 Regulates Actin-Dependent Processes Induced by the B Cell Antigen Receptor and Integrins

doi: 10.3390/cells12232704

Figure Lengend Snippet: WAVE2 is important for APC-induced B cell activation. Control siRNA- and WAVE2 siRNA-transfected primary B cells, as well as primary B cells that had been treated with CK-666 for 1 h, were added to COS-7 cells expressing the anti-Igκ surrogate Ag. The cells were co-cultured overnight before being stained for CD69 and IgM and analyzed via flow cytometry. ( A ) After gating on IgM + cells, forward/side scatter (top row) was used to identify single live B cells and quantify their CD69 fluorescence (bottom row). ( B ) The surrogate APC-induced increase in cell surface CD69 levels (left panel; geometric means) and percent CD69 + cells were calculated by subtracting the values for unstimulated B cells that were cultured without anti-Igκ-expressing COS-7 cells. Each colored dot is an independent experiment. The data are presented as the mean + SEM for the 3 experiments. p -values were calculated using the One-Way repeated measures ANOVA test.

Article Snippet: The membranes were blocked with 5% milk powder in Tris-buffered saline (10 mM of Tris-HCl, pH 8, and 150 of mM NaCl) and then incubated overnight at 4 °C with rabbit Abs to WAVE2 (Thermo Fisher, Waltham, MA, USA #PA5-60975, 1:200 dilution), phosphorylated CD79a (pCD79a; Cell Signaling Technologies, Danvers, MA, USA #5173, 1:1000), CD79a ([ ]; 1:5000), phospho-ERK (pERK; Cell Signaling Technologies, Danvers, MA, USA #9101, 1:1000), ERK (Cell Signaling Technologies, Danvers, MA, USA #9102; 1:1000), phospho-Akt S473 (pAkt; Cell Signaling Technologies, Danvers, MA, USA #9271; 1:1000), Akt (Cell Signaling Technologies, Danvers, MA, USA #9272; 1:1000), or NCKAP1L/Hem1 (Thermo Fisher, Waltham, MA, USA #PA5-58813; 1:500).

Techniques: Activation Assay, Control, Transfection, Expressing, Cell Culture, Staining, Flow Cytometry, Fluorescence

WAVE2 regulates B cell responses. By activating the Arp2/3 complex, the WAVE2-containing WRC contributes to the BCR- and integrin-induced actin remodeling that promotes cell spreading, actomyosin arc formation, and APC-induced BCR signaling. Created with BioRender . The red arrows represent downstream signaling from the BCR and integrins. For the images at the bottom of the figure, the integrin-induced spreading image is taken from B, the image showing actomyosin arcs is taken from D (the yellow arrowheads point to the actomyosin arcs), and the image for APC-induced BCR signaling is taken from A.

Journal: Cells

Article Title: WAVE2 Regulates Actin-Dependent Processes Induced by the B Cell Antigen Receptor and Integrins

doi: 10.3390/cells12232704

Figure Lengend Snippet: WAVE2 regulates B cell responses. By activating the Arp2/3 complex, the WAVE2-containing WRC contributes to the BCR- and integrin-induced actin remodeling that promotes cell spreading, actomyosin arc formation, and APC-induced BCR signaling. Created with BioRender . The red arrows represent downstream signaling from the BCR and integrins. For the images at the bottom of the figure, the integrin-induced spreading image is taken from B, the image showing actomyosin arcs is taken from D (the yellow arrowheads point to the actomyosin arcs), and the image for APC-induced BCR signaling is taken from A.

Article Snippet: The membranes were blocked with 5% milk powder in Tris-buffered saline (10 mM of Tris-HCl, pH 8, and 150 of mM NaCl) and then incubated overnight at 4 °C with rabbit Abs to WAVE2 (Thermo Fisher, Waltham, MA, USA #PA5-60975, 1:200 dilution), phosphorylated CD79a (pCD79a; Cell Signaling Technologies, Danvers, MA, USA #5173, 1:1000), CD79a ([ ]; 1:5000), phospho-ERK (pERK; Cell Signaling Technologies, Danvers, MA, USA #9101, 1:1000), ERK (Cell Signaling Technologies, Danvers, MA, USA #9102; 1:1000), phospho-Akt S473 (pAkt; Cell Signaling Technologies, Danvers, MA, USA #9271; 1:1000), Akt (Cell Signaling Technologies, Danvers, MA, USA #9272; 1:1000), or NCKAP1L/Hem1 (Thermo Fisher, Waltham, MA, USA #PA5-58813; 1:500).

Techniques: